Skip to content

Latest commit

 

History

16 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 

Repository files navigation

----------
----------
DAMe v1.0
----------
__________

------------
DESCRIPTION
------------

DAMe is a set of python scripts designed to perform the first steps in the analysis of very complicated datasets generated by metabarcoding laboratory methods that use double-tagged amplicons, PCR replicates, multiplexing, pooling samples, and sequencing with HTS technologies.

DAMe makes no assumptions on the used sequencing platform, and it is able to detect tag-jumpin events, chimeric sequences, sequencing errors, and contamination. DivA is a toolkit with python scripts that serve as tools to perform the first cleaning steps of a metabarcoding amplicon dataset following the next pipeline:

1.- Sort sequences from pooled samples by tag combination and collapse to unique sequences
2.- Optionally, remove chimeras using UCHIME in a de novo or reference-based fashion.
3.- Filter sequences that contain PCR/sequencing errors, chimeric sequences, sequences arising from contamination. 
4.- Optionally, the user can decollapse the unique sequences.

The final output can be directly used for any other program for taxonomic profiling.

------------
INSTALLATION
------------

DAMe is a set of python scripts that does not need any sort of compilation. It was developed in Python 2.7.3 and uses the following modules which are generally already installed in the user's system:

- re
- os
- sys
- subprocess
- string
- argparse
- optparse

Make sure to put DAMe's bin in your path. Alternatively, provide the full path when running the programs, making sure that the modules are in the same directory.


-------
USAGE
-------

######### 
sort.py  
#########

Usage

sort.py [-h] -fq FQ -p P -t T [--keepPrimersSeq]

Sort amplicon sequences tagged on each end by tag combination

Optional arguments:

•	-h, --help	Show this help message and exit
•	-fq FQ		Input fastq with amplicon sequences
•	-p P		Input text file with primer name and forward and reverse
sequences [Format: Name ForwardSeq ReverSeq]
•	-t T		Input text file with tag names and sequences [Format: TagSeq
TagName] 
•	--keepPrimersSeq  Use this parameter if you want to keep the primer
sequences from the amplicon instead of trimming it
[default not set]

Example:

python sort.py -fq Paul.AllOneLine.fastq -p Primers.txt -t Tags.txt

An example of the necessary input text files can be found in the “example” directory. 

Output

This program produces two types of output. For each identified tag combination a file named with the used tags is created containing the next tab separated fields: barcode name, forward tag name, reverse tag name, frequency of that sequence, sequence.

Example:

CO1	Tag7	Tag8	1	AGATATTGGAACATTATATTTTATTTTTGGGATTTGAGCTGGAATAGTAGAAACCTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCTGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTA

Also a file called “SummaryCounts.txt” is created which contains the next tab-separated fields: forward tag name, reverse tag name, total number of unique sequences, sum of the frequencies of the unique sequences. 

Example:

Tag3	Tag20	39	68


###############
chimeraCheck.py
###############

Usage

chimeraCheck.py [-h] -psInfo PSINFO -x X [-p P]

Create necessary files to operate on sequences per PCR reaction

Optional arguments:

•	-h, --help	Show this help message and exit
•	-psInfo PSINFO	Text file with the information on the tag combination in each
PCR reaction for every sample [Format: sampleName
TagNameForwardFromPCR1 TagNameReverseFromPCR1 Pool#
sampleName TagNameForwardFromPCR2 TagNameReverseFromPCR2
Pool# ...]
•	-x X		Number of PCR rxns performed per sample
•	-p P      		The number of pools in which the samples were divided for
sequencing (in case of tag combinations repetition due to
processing so many samples) [default 1] NOTE: If using
pools, each fastq must be in a folder called pool#, in which
the sort.py was run for each pool inside the corresponding
folder, and this program chimeraCheck.py is run in the
parent directory of the pools directories


Example:

python chimeraCheck.py -psInfo PCRsets_info.txt -x 2 

An example of the necessary text files can be found in the “example” directory. “PCRsets_info.txt” is an example of a laboratory set up that only used one pool for 61 different samples (dataset 1 from the paper). “PCRsetsInfo_pools.txt” is an example for when there is more than one pool. This file is the first part of the one used for dataset 2 in the paper.

Output

This program produces two types of output. One type is similar to one of the outputs form the sort.py tool, in which for each unique sequence after removing chimeras the tag names and the frequency is reported. The file name is the name of the tags, and the sufix noChin.txt (e.g. Tag5_Tag15.noChim.txt)

Example:

CO1	Tag5	Tag15	111	AGATATTGGAACATTATATTTTATTTTTGGGGCGTGGTCGGGCGCGGTAGGTATAGCTTTAAGCATAATTATCCGAACAGAGCTAGGTCATGCCGGGAGATTAATTGGAGACGATCAAATTTATAATGTAATTGTTACTGCACATGCTTTTGTAATAATTTTCTTTATAGTGATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTT

The second type of output is 4 different fasta files. The next fasta files are produced: One fasta file for each pool in which all the unique sequences are contained, and that is going to be sorted to produce a second fasta file in order to be used for removing chimeras. The step of removing chimeras produces two files, one containing the identified chimeric sequences and the ther containing only the non-chimeric sequences. 

The headers of the fasta files contan the next information: barcode name, forward tag name, reverse tag name, the number of times that sequence is found (its frequency).

Example:

>CO1_Tag2_Tag4_1;size=3
AGATATTGGAACATTATATTTTATTTTTGGAGTTTGATCTGCTATAGCAGGAACTGCTATAAGAGTATTAATTCGAATAGAGTTAGGAAATCCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTGGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTT


########## 
filter.py
##########

Usage

filter.py [-h] -psInfo PSINFO [-x X] [-y Y] [-p P] [-t T] [-l L] [--chimeraChecked]

Filter the multiplexed sequences by the presence of the sequence in the different PCR reactions at a given minimum abundance, and its length

Optional arguments:

•	-h, --help	Show this help message and exit
•	-psInfo PSINFO    Text file with the information on the tag combination in
each PCR reaction for every sample [Format: sampleName
TagNameForwardFromPCR1 TagNameReverseFromPCR1 Pool#
sampleName TagNameForwardFromPCR2 TagNameReverseFromPCR2
Pool# ...]
•	-x X		Number of PCR rxns performed per sample
•	-y Y		Number of PCR rxns in which the sequence has to be present
•	-p P 		The number of pools in which the samples were divided for
sequencing (in case of tag combinations repetition due to
processing so many samples) [default 1] NOTE: If using
pools, each fastq must be in a folder called pool#, in
which the sort.py was run for each pool inside the
corresponding folder, and this program chimeraCheck.py is
run in the parent directory of the pools directories
•	-t T		Number of times a unique sequence has to be present
•	-l L		Minimum sequence length
•	--chimeraChecked  Use this parameter if you have performed a chimera check
on the sorted collapsed sequence files [default not set]

Example:

python filter.py -psInfo PCRsets_info.txt -x 2 -y 2 -t 2 -l 211 -p 1 --chimeraChecked

An example of the necessary text files can be found in the “example” directory. “PCRsets_info.txt” is an example of a laboratory set up that only used one pool for 61 different samples (dataset 1 from the paper). “PCRsetsInfo_pools.txt” is an example for when there is more than one pool. This file is the first part of the one used for dataset 2 in the paper.

Output

This tool produces two types of output files: comparison files and fasta files. The fasta files are the fastas of every comparison step for which there is a text tab separated comparison file. The next comparison files are created: 

1.- A text file with the information of every unique sequence across the different PCR replicates is first created, called e.g “Comparisons_2PCRs.txt”. The tab-separated fields contain the next information: sample name, names of the tags used in each PCR replicate, the frequency of the sequence in each PCR replicate, the sequence.

Example:

Sample1	Tag2-Tag4	0	Tag3-Tag3	1	AGATATTGGAACATTATATTTTATTTTTGGAGTTTGGTCTGCTATAGCAGGAACAGCTATAAGAGTATTAATTCGAATAGAGTTAGGAAATCCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTGGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATGCCTATTATAATTGGAGGATTTGGAAATTGATTAGTA

2.- A second comparison file is created in which the records not passing the minimum reproducibility threshold are removed (e.g. “Comparisons_2outOf2PCRs.txt”)

3.- Then the minimum frequency threshold is applied (e.g. “Comparisons_2outOf2PCRs.countsThreshold2.txt”).

Finally, the minimum length threshold is applied and a fasta file called “FilteredReads.fna” is created. This is the last created file that should be used for any subsequent analysis. The header contains the next tab-separated information: sample name, names of the tags used on each PCR replicate, a unique sequence ID, the frequencies of the sequence in each PCR replicate.

Example:

>Sample1	Tag2-Tag4.Tag3-Tag3_7		3_11
AGATATTGGAACATTATATTTTATTTTTGGAGTTTGATCTGCTATAGCAGGAACTGCTATAAGAGTATTAATTCGAATAGAGTTAGGAAATCCTGGAAGATTATTAGGAGATGATCATTTATATAATGTAGTGGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTT


A similar fasta file is created for each of the comparison files previously described. 


#############
decollapse.py
#############

Usage

python decollapse.py [-h] -input INPUT [-outFas OUTFAS]

This program puts X number of times a sequence reported like this: Primer Tag1
Tag2 Freq Seq Qual Header. The utput is a fasta withe >Tag1.Tag2.Freq_RN ,
where RN is the writen line number in the output.

Arguments:

•	-h, --help	Show this help message and exit
•	-input INPUT    Text file with the information on the tag combination and
freq of each unique seq
•	-outFas OUTFAS  Output fasta wuth the unique sequences being repeated as
many times as their reported freq [default "Decollapsed.fasta"]


Example:

python decollapse.py -input Tag5_Tag8.txt -outFas Tag5_Tag8.decollapsed.fasta

Output

This tool outputs only one fasta file containing each unique sequence repeated as many times as its frequency. The header information is: names of the tags used on each PCR replicate, total frequency f that sequence, a unique sequence entry identifier.

Example:

>Tag7-Tag15.Tag9-Tag15.2_1
AGATATTGGAACTTTATATTTTATTTTTGGTGGTTTATCAGGAATGATAGGTACAGGATTTAGCGTAGTTATAAGATTAGAATTATCTAACCCAGGAGATTTATATTTAGCAGGAGATTATCAATTATATAATGTAATTATAACTGCTCACGCTTTTATTATGATTTTCTTCTTAGTTATGCCTGTATTAATAGGAGGATTTGGTAATTGATTAGTA
>Tag7-Tag15.Tag9-Tag15.2_2
AGATATTGGAACTTTATATTTTATTTTTGGTGGTTTATCAGGAATGATAGGTACAGGATTTAGCGTAGTTATAAGATTAGAATTATCTAACCCAGGAGATTTATATTTAGCAGGAGATTATCAATTATATAATGTAATTATAACTGCTCACGCTTTTATTATGATTTTCTTCTTAGTTATGCCTGTATTAATAGGAGGATTTGGTAATTGATTAGTA
>Tag7-Tag15.Tag9-Tag15.3_3
AGATATTGGAACTTTATATTTTATTTTTGGTGGTTTATCAGGAATGATAGGTACAGGATTTAGCGTAGTTATAAGATTAGAATTATCTAACCCAGGAGATTTATATTTAGCAGGAGATTATCAATTATATAATGTAATTATAACTGCTCACGCTTTTATTATGATTTTCTTCTTAGTTATGCCTGTATTAATAGGAGGATTTGGAAATTGATTAGTA
>Tag7-Tag15.Tag9-Tag15.3_4
AGATATTGGAACTTTATATTTTATTTTTGGTGGTTTATCAGGAATGATAGGTACAGGATTTAGCGTAGTTATAAGATTAGAATTATCTAACCCAGGAGATTTATATTTAGCAGGAGATTATCAATTATATAATGTAATTATAACTGCTCACGCTTTTATTATGATTTTCTTCTTAGTTATGCCTGTATTAATAGGAGGATTTGGAAATTGATTAGTA
>Tag7-Tag15.Tag9-Tag15.3_5
AGATATTGGAACTTTATATTTTATTTTTGGTGGTTTATCAGGAATGATAGGTACAGGATTTAGCGTAGTTATAAGATTAGAATTATCTAACCCAGGAGATTTATATTTAGCAGGAGATTATCAATTATATAATGTAATTATAACTGCTCACGCTTTTATTATGATTTTCTTCTTAGTTATGCCTGTATTAATAGGAGGATTTGGAAATTGATTAGTA


#############
RSI.py
#############

Usage

python RSI.py [-h help] [-e explicit] [-o output FILE] <in.txt>

Computes the Renkonen Similarity Index or Percentage Similarity Index between pairs of PCR replicates. The output file contains the means for the RSI values belonging to the same sample.

Optional arguments:

•	-h, --help	Show this help message and exit
•	-e, --explicit	For experiments with more than two replicates, 
the output can contain the RSI value for every pairwise 
comparison [default not set] 
•	-o FILE, --output=FILE      Output file name. If no file is provided, 
the output will be directed to ‘RSI_output.txt’.


Example:

python RSI.py  --explicit    Comparisons_4PCRs.txt

An example of the necessary text file can be found in the “example” directory with the name Comparisons_4PCRs.txt.

Output

This program can produce two different kinds of output files. The default output is a file with two tab-separated columns. The first column corresponds to the sample names and the second one to the mean of the RSI values of every pairwise comparison made between replicates from that specific sample.

Example:

Sample			RSI
X4				0.966666666667
pD9				0.347822352442
pD8				0.286781492997
pD7				0.665882105185
pD6				0.394603124201
pD5				0.611411834584

The alternative format of the output file is the ‘explicit’, option –e or --explicit. The difference with the previous one is that the means are not calculated. The RSI value of every pairwise comparison between two PCR replicates is explicitly shown in the output file.

Example:

Sample	ReplicateA	ReplicateB	RSI
X4      		1       		2       		1.0
X4      		1       		3       		1.0
X4      		1       		4       		1.0
X4      		2       		3       		1.0
X4      		2       		4       		1.0
X4      		3       		4       		0.8
pD9     		1       		2       		0.299253880574
pD9     		1       		3       		0.355540766835
pD9     		1       		4       		0.352368315049
pD9     		2      		3      	 	0.300623906013
pD9     		2       		4     	  	0.379322533242
pD9     		3       		4       		0.399824712943


-------
CITE
-------

Zepeda Mendoza, et al., (2015)  "DAMe: A Toolkit for the Initial Filtering Steps on complex Datasets from Double-tagged Amplicons for DNA Metabarcoding Analyses"

------------
CONTACT
-----------

For any enquiries correspondence is sent to lisandracady@gmail.com



About

DAMe: A Toolkit for the Initial Filtering Steps on Complex Datasets of PCR replicates from Pooled Double-tagged Amplicons for DNA Metabarcoding Analyses

Resources

Stars

3 stars

Watchers

3 watching

Forks

Releases

Packages

Contributors

Languages